Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br miR a mimic miR a inhibitor

    2020-08-28


    miR-34a mimic, miR-34a inhibitor, control mimic and control in-hibitor were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. PC-3 SYBR Safe DNA Gel Stain were seeded into dishes using medium with 10% FBS and no pe-nicillin/streptomycin; 24 h later, miRNA mimic/inhibitor and lipo-fectamine 2000 were mixed in serum-free medium and incubated for 20 min at room temperature to form miRNA–liposome complexes. Then the complexes were added to the cell culture. After incubated for 4 h, the medium was replaced with the fresh culture medium or culture medium containing 10−7 mol/L BBP. The expression of miR-34a and its related protein levels were assayed after 72 h and 6 days by quantitative real-time PCR and Western blot analysis, respectively.
    2.6. Quantitative real-time PCR
    Total RNA was extracted from cells using TRIZOL (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. One mi-crogram RNA was reversely transcribed to cDNA using Thermoscript RT kits (TAKALA, Japan). Quantitative real-time PCR was performed using the Power SYBR Green Master Mix (Applied Biosystems, USA) and the ABI 7300 real-time PCR detection system (Applied Biosystems, USA). Forward (F) and reverse (R) primers of mRNAs were as follows:
    Cyclin D1: Forward 5′-CGTGGCCTCTAAGATGAAGG-3′; Reverse5′-TGCGGATGATCTGTTTGTTC-3′.
    PCNA: Forward5′ CTGAAGCCGAAACCAGCTAGACT 3′; Reverse5′ TCGTTGATGAGGTCCTTGAGTGC3′.
    p21: Forward5′-GACACCACTGGAGGGTGACT-3′; Reverse5′-CAGGTCCACATGGTCTTCCT-3′. c-myc:Forward5′CATCCACGAAACTTTGCCCATAG3′; Reverse5′ CCTTTCAGAGAAGCGGGTCC3′.
    GAPDH:Forward5′-GTCAGTGGTGGACCTGACCT-3′; Reverse 5′-A-
    GGGGAGATTCAGTGTGGTG-3′.
    All the mRNA primers were synthesized by Invitrogen (Carlsbad, CA, USA). The miRNA primers were synthesized by RIBOBIO (Guangzhou, China). Expression of miRNAs was analyzed using miRNAs sequence-specific primers. The U6 snRNA and GAPDH were used as internal controls. Fold changes in expression of each gene were
    calculated by a comparative threshold cycle (Ct) method using the formula 2−(ΔΔCt).
    2.7. Statistical analysis
    All data are expressed as mean ± standard deviation. One-way ANOVA was used for comparison of statistical differences among mul-tiple groups. Unpaired Student t-test was used for the comparison be-tween two groups, using GraphPad Prism 5.0 software. A value of p < .05 was considered significantly different.
    3. Results
    3.1. BBP promoted the proliferation of prostate cancer cells
    Phthalate esters have been defined as environmental endocrine disruptors, which may promote the progress of cancer. BBP is a typical phthalate ester. In order to investigate the effect of BBP on cell pro-liferation of prostate cancer, we first examined the viability of prostate cancer cells after BBP treatment. LNCaP and PC-3 cells were cultured with different doses of BBP (0,10−4,10−5,10−6,10−7 and 10−8 mol/L) for 6 days. Since BBP is not colored nor MTT reducer, the viability of prostate cancer cells was measured by MTT assay. As shown in Fig. 1, BBP increased the viability of both LNCaP and PC-3 cells with 6 days treatment. 10−6 and 10−7 mol/L BBP increased 32% and 28% cell survival in LNCaP cells respectively (p < 0.05, Fig. 1A). In PC-3 cells, 10−6 and 10−7 mol/L BBP exposure elevated the cell viability to 120% and 119% respectively when compared with the control group (p < 0.05, Fig. 1B).
    3.2. BBP altered the expression of cell cycle genes in prostate cancer cells
    Cell cycle plays a vital role in the proliferation of cancer cells. CylinD1, PCNA and p21 are key molecules in cell cycle regulation, especially in checkpoint regulation. Quantitative real-time PCR and western blotting were used to detect the mRNA and protein levels of cylinD1, PCNA and p21 after BBP treatment. As shown in Fig. 2A, the mRNA levels of cylinD1 and PCNA were up-regulated in both LNCaP and PC-3 cell lines when exposed to BBP for 6 days compared with control group (p < 0.05). Meanwhile, the cell cycle arrest gene p21 was down-regulated at mRNA level with BBP treatment (p < 0.05). The western blotting results also shown that BBP increased cyclinD1 and PCNA protein levels and decreased p21 protein level in LNCaP and PC-3 cell lines (Fig. 2B), which consisted with the quantitative real-time PCR results. These data demonstrated that low dose of BBP induced cell proliferation through promoting cell cycle in prostate cancer cells.
    3.3. BBP downregualted miR-34a expression in prostate cancer cells
    Mounting evidence has demonstrated that miR-34a is a tumor su-pressor miRNA in cell cycle and growth regulation of cancer cells. Thus we used quantitative real-time PCR to detect miR-34a level in prostate cancer cells with BBP exposure. Results indicated that miR-34a was decreased significantly after BBP (10−6 and 10−7 mol/L) treatment in both LNCaP and PC-3 cells (p < 0.05, Fig. 3A). c-myc was reported to be a direct target of miR-34a in proliferation regulation of cancer cells. Then we detected the mRNA and protein level of c-myc. The results